BGI 5128 PDF

*Exchange rate ref. BCCR. The supplier can change the price of the product. Aeropost is an online shopping services provider. Total price includes all charges . NM_c+A>G; NM_c+A>T . ss, BGI|BGI_rs, fwd/B, C/T, aatggcaaaatgataaattgtggtcttctg. ss, BGI|BGI_rs, rev/B, G/T, ctgttgagtgaaggctgtgttcttggaggg, agtattctttgaataaactgatgaattcca, 06/06/08, 06/18/09, , Genomic, unknown.

Author: Brat Viran
Country: El Salvador
Language: English (Spanish)
Genre: Science
Published (Last): 23 December 2011
Pages: 420
PDF File Size: 10.71 Mb
ePub File Size: 4.83 Mb
ISBN: 858-9-30756-795-2
Downloads: 87612
Price: Free* [*Free Regsitration Required]
Uploader: Tur

Draft genome of the lined seahorse, Hippocampus erectus | GigaScience | Oxford Academic

Oxford University Press is a department of the University of Oxford. Here, we provide whole genome sequencing, assembly, and gene annotation of the lined seahorse, which can enrich genome resource and further application for its molecular breeding.

Identification of the catalytic base. Previously classified as 2-nitropropane dioxygenase EC 1. C ]; O2 [CPD: The contig N50 and scaffold N50 reached Using homology-based, de novo and transcriptome-based prediction methods, we predicted 20 protein-coding genes in the generated assembly, which is less than our previously reported gene number 23 of the tiger tail seahorse H.

  BRUNO FERRERO KNYGOS PDF

Close mobile search navigation Article navigation.

Oxidoreductases; Acting on single donors with incorporation of molecular bbi oxygenases ; With incorporation of one atom of oxygen internal monooxygenases or internal mixed-function oxidases. Gadda G, Francis K. Biochim Biophys Acta Citing articles via Web of Science 2. Draft genome of the lined seahorse, Hippocampus erectus Qiang Lin. R R R R R Related articles in Web of Science Google Scholar.

Sponsors of Barbados Gospelfest 2018 “Touching Lives Changing Nations”

Bpet Bpet Bpet Bpet Xun L, Sandvik ER. Characterization of 4-hydroxyphenylacetate 3-hydroxylase HpaB of Escherichia coli as a reduced flavin adenine dinucleotide-utilizing monooxygenase. It furthers the University’s objective of excellence in research, scholarship, and education by publishing worldwide.

Oxidoreductases; Acting on paired donors, with incorporation or reduction of molecular oxygen; With reduced flavin or flavoprotein as one donor, and incorporation of one atom 51128 oxygen into the bhi donor. C ]; nitrite [CPD: Email alerts New issue alert. Involvement of a flavosemiquinone in the enzymatic oxidation of nitroalkanes catalyzed by 2-nitropropane dioxygenase.

  LEAVING THE BODY SCOTT ROGO PDF

Receive exclusive offers and updates from Oxford Academic. We report a draft genome of the lined seahorse. J Biol Chem A total of The enzyme from N. ExplorEnz – The Enzyme Database: ExplorEnz – The Enzyme Database: In progress issue alert.

Francis K, Gadda G. Kinetic evidence for an anion binding pocket in the active site of nitronate monooxygenase.

Active towards linear alkyl nitronates of lengths between 2 and 6 carbon atoms and, with lower activity, towards propylnitronate. Re analyzing community-wide datasets without bhi infrastructure. These generated genomic data are going to enrich genome resource of this economically important fish, and also provide insights into the genetic mechanisms of its iconic morphology and male pregnancy behavior. The enzyme from Escherichia coli attacks a broad spectrum of phenolic compounds.

Author: admin